Stem-loop sequence cpo-mir-335

AccessionMI0038733 (change log)
DescriptionCavia porcellus miR-335 stem-loop
Stem-loop
   --   a         c        u  gu 
5'   uca gagcaauaa gaaaaaug uu  c
     ||| ||||||||| |||||||| ||   
3'   agu cucguuauu cuuuuugc aa  a
   cc   c         a        c  au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562866.1: 50759609-50759666 [+]
intergenic
Database links

Mature sequence cpo-miR-335-5p

Accession MIMAT0047170
Sequence

1 - 

ucaagagcaauaacgaaaaaug

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-335-3p

Accession MIMAT0047171
Sequence

37 - 

uuuuucauuauugcuccugacc

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).