Stem-loop sequence cpo-mir-328

AccessionMI0038729 (change log)
DescriptionCavia porcellus miR-328 stem-loop
Stem-loop
   --          -   u   u     agaaa  gu 
5'   gggggggcag gag ggc caggg     gc  g
     |||||||||| ||| ||| |||||     ||  u
3'   ucuucccguc cuc ccg guccc     cg  a
   ug          u   -   -     -----  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562877.1: 9382914-9382976 [+]
intergenic
Database links

Mature sequence cpo-miR-328-5p

Accession MIMAT0047162
Sequence

1 - 

gggggggcaggaguggcucaggg

 - 23

Get sequence
Evidence not experimental

Mature sequence cpo-miR-328-3p

Accession MIMAT0047163
Sequence

42 - 

cuggcccucucugcccuucugu

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).