Stem-loop sequence cpo-mir-326

AccessionMI0038728 (change log)
DescriptionCavia porcellus miR-326 stem-loop
Stem-loop
   --     c       uugu  a     gugu 
5'   ggggg agggccu    ga ggcgg    g
     ||||| |||||||    || |||||    c
3'   ccucc ucccggg    cu ccgcu    a
   ga     u       ---u  -     agaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562958.1: 327534-327592 [+]
intergenic
Database links

Mature sequence cpo-miR-326-5p

Accession MIMAT0047160
Sequence

1 - 

gggggcagggccuuugugaaggcg

 - 24

Get sequence
Evidence not experimental

Mature sequence cpo-miR-326-3p

Accession MIMAT0047161
Sequence

40 - 

ccucugggcccuuccuccag

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).