Stem-loop sequence cpo-mir-324

AccessionMI0038727 (change log)
DescriptionCavia porcellus miR-324 stem-loop
Stem-loop
   --c   u c   a     u   u  aaag 
5'    gca c ccu gggca ugg gu    c
      ||| | ||| ||||| ||| ||     
3'    cgu g gga cccgu acc ca    u
   ggu   c u   c     c   -  gagg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562916.1: 9396938-9396994 [+]
intergenic
Database links

Mature sequence cpo-miR-324-5p

Accession MIMAT0047158
Sequence

1 - 

cgcauccccuagggcauuggugu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-324-3p

Accession MIMAT0047159
Sequence

36 - 

ccacugccccaggugcugcugg

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).