Stem-loop sequence cpo-mir-323b

AccessionMI0038726 (change log)
DescriptionCavia porcellus miR-323b stem-loop
Stem-loop
   --        c      -ca   -     u 
5'   agagguug cugugg   ugu ucgca c
     |||||||| ||||||   ||| ||||| c
3'   ucuccaac ggcacu   acg agugu c
   uc        u      aac   c     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 1118056-1118114 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-323b
cpo-mir-485DS562966.1: 1108140-1108198 [+]
cpo-mir-154DS562966.1: 1112305-1112362 [+]
cpo-mir-496DS562966.1: 1113040-1113093 [+]
cpo-mir-377DS562966.1: 1114436-1114495 [+]
cpo-mir-541DS562966.1: 1116256-1116321 [+]
cpo-mir-409DS562966.1: 1117072-1117125 [+]
cpo-mir-412DS562966.1: 1117221-1117276 [+]
cpo-mir-369DS562966.1: 1117336-1117391 [+]
cpo-mir-410DS562966.1: 1117656-1117711 [+]
cpo-mir-323bDS562966.1: 1118056-1118114 [+]
cpo-mir-656DS562966.1: 1118353-1118408 [+]
Database links

Mature sequence cpo-miR-323b-5p

Accession MIMAT0047156
Sequence

1 - 

agagguugccuguggcauguuc

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-323b-3p

Accession MIMAT0047157
Sequence

38 - 

cacaaucacggucaaccucucu

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).