Stem-loop sequence cpo-mir-323a

AccessionMI0038725 (change log)
DescriptionCavia porcellus miR-323a stem-loop
Stem-loop
   --    g u     gcgc  u    uuu 
5'   aggu g ccgug    gu cgcu   u
     |||| | |||||    || ||||    
3'   ucca c ggcac    ca gcgg   u
   uc    g u     auua  c    uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 1085632-1085687 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-323a
cpo-mir-379DS562966.1: 1082082-1082140 [+]
cpo-mir-411DS562966.1: 1083271-1083326 [+]
cpo-mir-299DS562966.1: 1083722-1083784 [+]
cpo-mir-380DS562966.1: 1084914-1084970 [+]
cpo-mir-1197DS562966.1: 1085473-1085528 [+]
cpo-mir-323aDS562966.1: 1085632-1085687 [+]
cpo-mir-758DS562966.1: 1085914-1085971 [+]
cpo-mir-329DS562966.1: 1086616-1086675 [+]
cpo-mir-494DS562966.1: 1088359-1088414 [+]
cpo-mir-1193DS562966.1: 1088694-1088748 [+]
cpo-mir-543DS562966.1: 1090491-1090547 [+]
cpo-mir-495DS562966.1: 1091798-1091855 [+]
cpo-mir-376cDS562966.1: 1095062-1095119 [+]
cpo-mir-376dDS562966.1: 1095388-1095445 [+]
cpo-mir-654DS562966.1: 1095544-1095600 [+]
Database links

Mature sequence cpo-miR-323a-5p

Accession MIMAT0047154
Sequence

1 - 

aggugguccguggcgcguucg

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-323a-3p

Accession MIMAT0047155
Sequence

36 - 

cacauuacacggucgaccucu

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).