Stem-loop sequence cpo-mir-302d

AccessionMI0038724 (change log)
DescriptionCavia porcellus miR-302d stem-loop
Stem-loop
   --a   c        -       -c  c gc 
5'    cuc gacauggg gcacuug  ug g  g
      ||| |||||||| |||||||  || |   
3'    gag uuguaccu cgugaau  ac c  u
   cgc   u        u       aa  u ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562898.1: 11471856-11471915 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-302d
cpo-mir-302bDS562898.1: 11472221-11472282 [-]
cpo-mir-302cDS562898.1: 11472099-11472157 [-]
cpo-mir-302aDS562898.1: 11471972-11472035 [-]
cpo-mir-302dDS562898.1: 11471856-11471915 [-]
cpo-mir-367DS562898.1: 11471746-11471805 [-]
Database links

Mature sequence cpo-miR-302d-5p

Accession MIMAT0047152
Sequence

1 - 

acuccgacauggggcacuugcu

 - 22

Get sequence
Evidence not experimental

Mature sequence cpo-miR-302d-3p

Accession MIMAT0047153
Sequence

38 - 

uaagugcuuccauguuugagcgc

 - 60

Get sequence
Evidence not experimental

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).