Stem-loop sequence cpo-mir-302c

AccessionMI0038723 (change log)
DescriptionCavia porcellus miR-302c stem-loop
Stem-loop
   --    u             c    gug a 
5'   gcuu aacauggggguac ugcu   c a
     |||| ||||||||||||| ||||   |  
3'   ugag uuguaccuucgug auga   g a
   gg    u             a    -aa g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562898.1: 11472099-11472157 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-302c
cpo-mir-302bDS562898.1: 11472221-11472282 [-]
cpo-mir-302cDS562898.1: 11472099-11472157 [-]
cpo-mir-302aDS562898.1: 11471972-11472035 [-]
cpo-mir-302dDS562898.1: 11471856-11471915 [-]
cpo-mir-367DS562898.1: 11471746-11471805 [-]
Database links

Mature sequence cpo-miR-302c-5p

Accession MIMAT0047150
Sequence

1 - 

gcuuuaacauggggguaccugcu

 - 23

Get sequence
Evidence not experimental

Mature sequence cpo-miR-302c-3p

Accession MIMAT0047151
Sequence

37 - 

uaagugcuuccauguuugagugg

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).