Stem-loop sequence cpo-mir-302b

AccessionMI0038722 (change log)
DescriptionCavia porcellus miR-302b stem-loop
Stem-loop
   --   cu               u   gccuu 
5'   acu  aacguggaggcacuu cug     g
     |||  ||||||||||||||| |||      
3'   uga  uuguaccuucgugaa gac     c
   ga   uu               u   aacag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562898.1: 11472221-11472282 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-302b
cpo-mir-302bDS562898.1: 11472221-11472282 [-]
cpo-mir-302cDS562898.1: 11472099-11472157 [-]
cpo-mir-302aDS562898.1: 11471972-11472035 [-]
cpo-mir-302dDS562898.1: 11471856-11471915 [-]
cpo-mir-367DS562898.1: 11471746-11471805 [-]
Database links

Mature sequence cpo-miR-302b-5p

Accession MIMAT0047148
Sequence

1 - 

acucuaacguggaggcacuuucu

 - 23

Get sequence
Evidence not experimental

Mature sequence cpo-miR-302b-3p

Accession MIMAT0047149
Sequence

40 - 

uaagugcuuccauguuuuaguag

 - 62

Get sequence
Evidence not experimental

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).