Stem-loop sequence cpo-mir-301b

AccessionMI0038720 (change log)
DescriptionCavia porcellus miR-301b stem-loop
Stem-loop
   --   c      ---g        a  gug u 
5'   gcu ugacga    guugcacu cu   c c
     ||| ||||||    |||||||| ||   | u
3'   cga acuguu    uaacguga ga   g g
   ua   a      auag        c  --a a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562859.1: 19664333-19664392 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-301b
cpo-mir-301bDS562859.1: 19664333-19664392 [+]
cpo-mir-130bDS562859.1: 19664670-19664729 [+]
Database links

Mature sequence cpo-miR-301b-5p

Accession MIMAT0047144
Sequence

1 - 

gcucugacgagguugcacuacu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-301b-3p

Accession MIMAT0047145
Sequence

36 - 

cagugcaaugauauugucaaagcau

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).