Stem-loop sequence cpo-mir-301a

AccessionMI0038719 (change log)
DescriptionCavia porcellus miR-301a stem-loop
Stem-loop
   --   c    ---u          ----a       
5'   gcu ugac    uuauugcacu     cuguac 
     ||| ||||    ||||||||||     ||||| u
3'   cga acug    gauaacguga     gacauu 
   ua   a    uuau          cgauc       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562887.1: 7094160-7094221 [-]
intergenic
Database links

Mature sequence cpo-miR-301a-5p

Accession MIMAT0047142
Sequence

1 - 

gcucugacuuuauugcacuacu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-301a-3p

Accession MIMAT0047143
Sequence

38 - 

cagugcaauaguauugucaaagcau

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).