Stem-loop sequence cpo-mir-299

AccessionMI0038718 (change log)
DescriptionCavia porcellus miR-299 stem-loop
        a                      uu 
5' aagaa ugguuuaccgucccacauacau  u
   ||||| ||||||||||||||||||||||  g
3' uucuu gccaaauggcaggguguaugua  g
        c                      ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 1083722-1083784 [+]
Clustered miRNAs
< 10kb from cpo-mir-299
cpo-mir-379DS562966.1: 1082082-1082140 [+]
cpo-mir-411DS562966.1: 1083271-1083326 [+]
cpo-mir-299DS562966.1: 1083722-1083784 [+]
cpo-mir-380DS562966.1: 1084914-1084970 [+]
cpo-mir-1197DS562966.1: 1085473-1085528 [+]
cpo-mir-323aDS562966.1: 1085632-1085687 [+]
cpo-mir-758DS562966.1: 1085914-1085971 [+]
cpo-mir-329DS562966.1: 1086616-1086675 [+]
cpo-mir-494DS562966.1: 1088359-1088414 [+]
cpo-mir-1193DS562966.1: 1088694-1088748 [+]
cpo-mir-543DS562966.1: 1090491-1090547 [+]
cpo-mir-495DS562966.1: 1091798-1091855 [+]
Database links

Mature sequence cpo-miR-299-5p

Accession MIMAT0047140

7 - 


 - 27

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-299-3p

Accession MIMAT0047141

39 - 


 - 60

Get sequence
Evidence experimental; Illumina [1]


PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).