Stem-loop sequence cpo-mir-296

AccessionMI0038717 (change log)
DescriptionCavia porcellus miR-296 stem-loop
Stem-loop
   --      c  c         g   u    
5'   agggcc cc cucaauccu uug gcu 
     |||||| || ||||||||| ||| || a
3'   ucucgg gg ggguuggga gac uga 
   cc      a  u         -   u    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS563011.1: 1090312-1090367 [-]
intergenic
Database links

Mature sequence cpo-miR-296-5p

Accession MIMAT0047138
Sequence

1 - 

agggcccccccucaauccugu

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-296-3p

Accession MIMAT0047139
Sequence

36 - 

aggguuggguggaggcucucc

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).