Stem-loop sequence cpo-mir-224

AccessionMI0038716 (change log)
DescriptionCavia porcellus miR-224 stem-loop
Stem-loop
   --ua         u   u      a --ua     u 
5'     agucacuag ggu ccguuu g    gaugu u
       ||||||||| ||| |||||| |    |||||  
3'     ucagugauc ccg gguaaa c    uuacg g
   aaca         -   u      a uuug     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS563052.1: 1056776-1056844 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-224
cpo-mir-452DS563052.1: 1057810-1057870 [-]
cpo-mir-224DS563052.1: 1056776-1056844 [-]
Database links

Mature sequence cpo-miR-224-5p

Accession MIMAT0047136
Sequence

1 - 

uaagucacuagugguuccguuuag

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-224-3p

Accession MIMAT0047137
Sequence

47 - 

aaauggugcccuagugacuacaa

 - 69

Get sequence
Evidence not experimental

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).