Stem-loop sequence cpo-mir-222

AccessionMI0038714 (change log)
DescriptionCavia porcellus miR-222 stem-loop
Literature search

1 open access papers mention cpo-mir-222
(2 sentences)

Stem-loop
   --              -     auc   ucuu 
5'   ggcucaguagccag uguag   cug    u
     |||||||||||||| |||||   |||    u
3'   cugggucaucgguc acauc   gac    g
   cu              u     gac   uaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562888.1: 12034584-12034647 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-222
cpo-mir-222DS562888.1: 12034584-12034647 [+]
cpo-mir-221DS562888.1: 12035274-12035336 [+]
Database links

Mature sequence cpo-miR-222-5p

Accession MIMAT0047132
Sequence

1 - 

ggcucaguagccaguguagaucc

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-222-3p

Accession MIMAT0047133
Sequence

41 - 

agcuacaucuggcuacugggucuc

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).