Stem-loop sequence cpo-mir-221

AccessionMI0038713 (change log)
DescriptionCavia porcellus miR-221 stem-loop
Stem-loop
   ---   ug   u         auuu    -      
5'    acc  gca acaauguag    cugu guuug 
      |||  ||| |||||||||    |||| |||| u
3'    ugg  cgu uguuacauc    gaca caagu 
   cuu   gu   c         ----    a      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562888.1: 12035274-12035336 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-221
cpo-mir-222DS562888.1: 12034584-12034647 [+]
cpo-mir-221DS562888.1: 12035274-12035336 [+]
Database links

Mature sequence cpo-miR-221-5p

Accession MIMAT0047130
Sequence

1 - 

accuggcauacaauguagauuucugu

 - 26

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-221-3p

Accession MIMAT0047131
Sequence

41 - 

agcuacauugucugcuggguuuc

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).