Stem-loop sequence cpo-mir-219b

AccessionMI0038712 (change log)
DescriptionCavia porcellus miR-219b stem-loop
Stem-loop
   --u   u     aa           uac a  c 
5'    gau gucca  cgcaauucuug   g gu u
      ||| |||||  |||||||||||   | || g
3'    cua caggu  guguuaagagc   c cg c
   ugu   -     cg           caa -  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562882.1: 3805724-3805788 [+]
intergenic
Database links

Mature sequence cpo-miR-219b-5p

Accession MIMAT0047128
Sequence

1 - 

ugauuguccaaacgcaauucuug

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-219b-3p

Accession MIMAT0047129
Sequence

44 - 

agaauuguggcuggacaucugu

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).