Stem-loop sequence cpo-mir-217

AccessionMI0038709 (change log)
DescriptionCavia porcellus miR-217 stem-loop
Stem-loop
   --auac     c          u -   aag 
5'       ugcau aggaacugau g gau   a
         ||||| |||||||||| | |||    
3'       acgua uccuugacua c cug   a
   uccguu     a          c a   acu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562903.1: 8653829-8653889 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-217
cpo-mir-216aDS562903.1: 8647413-8647474 [+]
cpo-mir-217DS562903.1: 8653829-8653889 [+]
Database links

Mature sequence cpo-miR-217-5p

Accession MIMAT0047123
Sequence

1 - 

auacugcaucaggaacugauug

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-217-3p

Accession MIMAT0047124
Sequence

40 - 

aucaguuccuaaugcauugccu

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).