Stem-loop sequence cpo-mir-216b

AccessionMI0038708 (change log)
DescriptionCavia porcellus miR-216b stem-loop
Stem-loop
   --a     c      --caaa      g  ac 
5'    aaucu ugcagg      ugugau uc  u
      ||||| ||||||      |||||| ||   
3'    uuaga augucc      acacua ag  g
   guc     a      auucac      -  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562903.1: 8638120-8638180 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-216b
cpo-mir-216bDS562903.1: 8638120-8638180 [+]
cpo-mir-216aDS562903.1: 8647413-8647474 [+]
Database links

Mature sequence cpo-miR-216b-5p

Accession MIMAT0047121
Sequence

1 - 

aaaucucugcaggcaaauguga

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-216b-3p

Accession MIMAT0047122
Sequence

40 - 

acacuuaccuguaaagauucug

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).