Stem-loop sequence cpo-mir-215

AccessionMI0038706 (change log)
DescriptionCavia porcellus miR-215 stem-loop
Stem-loop
   --a  a      -  u        -   gug 
5'    ug ccuaca aa ugacagac gau   c
      || |||||| || |||||||| |||    
3'    ac ggaugu uu acugucug cug   c
   aca  c      c  c        u   agu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562868.1: 2522064-2522123 [+]
intergenic
Database links

Mature sequence cpo-miR-215-5p

Accession MIMAT0047117
Sequence

1 - 

augaccuacaaauugacagacg

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-215-3p

Accession MIMAT0047118
Sequence

38 - 

ucugucacuucuguaggccaaca

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).