Stem-loop sequence cpo-mir-214

AccessionMI0038705 (change log)
DescriptionCavia porcellus miR-214 stem-loop
Stem-loop
   --         aca            aacau 
5'   ugccugucu   cuugcugugcag     c
     |||||||||   ||||||||||||     c
3'   acggacaga   ggacgacauguc     g
   ug         cac            cacuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562867.1: 11468170-11468232 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-214
cpo-mir-199-2DS562867.1: 11462616-11462676 [+]
cpo-mir-214DS562867.1: 11468170-11468232 [+]
Database links

Mature sequence cpo-miR-214-5p

Accession MIMAT0047115
Sequence

1 - 

ugccugucuacacuugcugugc

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-214-3p

Accession MIMAT0047116
Sequence

42 - 

acagcaggcacagacaggcagu

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).