Stem-loop sequence cpo-mir-212

AccessionMI0038704 (change log)
DescriptionCavia porcellus miR-212 stem-loop
Stem-loop
   --a  u     cu      c      ccc     
5'    cc uggcu  agacug uuacug   gggc 
      || |||||  |||||| ||||||   ||| c
3'    gg acuga  ucugac aaugac   cccg 
   acc  c     cc      -      --u     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562887.1: 20418791-20418852 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-212
cpo-mir-212DS562887.1: 20418791-20418852 [+]
cpo-mir-132DS562887.1: 20419190-20419247 [+]
Database links

Mature sequence cpo-miR-212-5p

Accession MIMAT0047113
Sequence

1 - 

accuuggcucuagacugcuuacu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-212-3p

Accession MIMAT0047114
Sequence

41 - 

uaacagucuccagucacggcca

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).