Stem-loop sequence cpo-mir-211

AccessionMI0038703 (change log)
DescriptionCavia porcellus miR-211 stem-loop
Stem-loop
   --u         ca     u    agggc 
5'    ucccuuugu  uccuu gccu     u
      |||||||||  ||||| ||||      
3'    ggggaaacg  aggga cggg     c
   cau         uc     -    auagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562865.1: 48990198-48990254 [-]
intergenic
Database links

Mature sequence cpo-miR-211-5p

Accession MIMAT0047111
Sequence

1 - 

uucccuuugucauccuuugccu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-211-3p

Accession MIMAT0047112
Sequence

37 - 

gcagggacugcaaagggguac

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).