Stem-loop sequence cpo-mir-210

AccessionMI0038702 (change log)
DescriptionCavia porcellus miR-210 stem-loop
Stem-loop
   gcgcaggg     a   cc   -      c  c c  c 
5'         cagcc cug  cac cgcaca ug g ug u
           ||||| |||  ||| |||||| || | ||  
3'         gucgg gac  gug gcgugu ac c gc c
   -------a     c   -a   u      c  c a  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS563073.1: 305335-305403 [+]
intergenic
Database links

Mature sequence cpo-miR-210-5p

Accession MIMAT0047109
Sequence

10 - 

agccacugcccaccgcacacug

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-210-3p

Accession MIMAT0047110
Sequence

48 - 

cugugcgugugacagcggcuga

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).