Stem-loop sequence cpo-mir-208b

AccessionMI0038701 (change log)
DescriptionCavia porcellus miR-208b stem-loop
Stem-loop
   --          c   aa        cu 
5'   aagcuuuuug ucg  uuauguuu  c
     |||||||||| |||  ||||||||  a
3'   uuuggaaaac agc  aauauaaa  u
   ug          a   ag        cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562868.1: 17445268-17445324 [+]
intergenic
Database links

Mature sequence cpo-miR-208b-5p

Accession MIMAT0047107
Sequence

1 - 

aagcuuuuugcucgaauuaugu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-208b-3p

Accession MIMAT0047108
Sequence

36 - 

auaagacgaacaaaagguuugu

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).