Stem-loop sequence cpo-mir-208a

AccessionMI0038700 (change log)
DescriptionCavia porcellus miR-208a stem-loop
Stem-loop
   --        g  c  gg      cuaa 
5'   gagcuuuu gc cg  uuauac    u
     |||||||| || ||  ||||||    g
3'   uucgaaaa cg gc  aauaug    c
   ug        a  a  ag      cacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562868.1: 17471070-17471126 [+]
intergenic
Database links

Mature sequence cpo-miR-208a-5p

Accession MIMAT0047105
Sequence

1 - 

gagcuuuuggcccggguuauac

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-208a-3p

Accession MIMAT0047106
Sequence

36 - 

auaagacgagcaaaaagcuugu

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).