Stem-loop sequence cpo-mir-206

AccessionMI0038699 (change log)
DescriptionCavia porcellus miR-206 stem-loop
Stem-loop
   --                cc      g  u 
5'   acaugcuucuuuauau  ccauag ga u
     ||||||||||||||||  |||||| || a
3'   ugugugaaggaaugua  gguauc uu c
   gg                -a      g  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562867.1: 49857882-49857941 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-206
cpo-mir-206DS562867.1: 49857882-49857941 [+]
cpo-mir-133bDS562867.1: 49862235-49862293 [+]
Database links

Mature sequence cpo-miR-206-5p

Accession MIMAT0047103
Sequence

1 - 

acaugcuucuuuauauccccaua

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-206-3p

Accession MIMAT0047104
Sequence

39 - 

uggaauguaaggaagugugugg

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).