Stem-loop sequence cpo-mir-205

AccessionMI0038698 (change log)
DescriptionCavia porcellus miR-205 stem-loop
Stem-loop
   --uc           c        uc    
5'     cuucauuccac ggagucug  ugc 
       ||||||||||| ||||||||  || g
3'     gaagugaggug cuucagac  acg 
   acuc           a        ca    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562867.1: 13745521-13745577 [-]
intergenic
Database links

Mature sequence cpo-miR-205-5p

Accession MIMAT0047101
Sequence

1 - 

uccuucauuccaccggagucugu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-205-3p

Accession MIMAT0047102
Sequence

36 - 

gacuucaguggagugaagcuca

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).