Stem-loop sequence cpo-mir-204

AccessionMI0038697 (change log)
DescriptionCavia porcellus miR-204 stem-loop
Stem-loop
   --u          a     u    gagaau 
5'    ucccuuuguc uccua gccu      a
      |||||||||| ||||| ||||      u
3'    agggaaacgg agggu cgga      a
   ugc          a     -    ggaagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562876.1: 21988247-21988306 [-]
intergenic
Database links

Mature sequence cpo-miR-204-5p

Accession MIMAT0047099
Sequence

1 - 

uucccuuugucauccuaugccu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-204-3p

Accession MIMAT0047100
Sequence

40 - 

gcugggaaggcaaagggacgu

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).