Stem-loop sequence cpo-mir-203

AccessionMI0038696 (change log)
DescriptionCavia porcellus miR-203 stem-loop
Stem-loop
   --         u    g    a     -  g 
5'   agugguucu aaca uuca caguu cu u
     ||||||||| |||| |||| ||||| ||  
3'   ucaccagga uugu aagu guuaa gg a
   ga         u    a    -     c  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 3483108-3483167 [+]
intergenic
Database links

Mature sequence cpo-miR-203-5p

Accession MIMAT0047097
Sequence

1 - 

agugguucuuaacaguucaacag

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-203-3p

Accession MIMAT0047098
Sequence

39 - 

gugaaauguuuaggaccacuag

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).