Stem-loop sequence cpo-mir-202

AccessionMI0038695 (change log)
DescriptionCavia porcellus miR-202 stem-loop
Stem-loop
   --         -            g   au 
5'   uuccuaugc auauacuucuuu agg  c
     ||||||||| |||||||||||| |||   
3'   aaggguacg uauauggagaaa ucc  u
   aa         g            -   gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562856.1: 34864191-34864248 [+]
intergenic
Database links

Mature sequence cpo-miR-202-5p

Accession MIMAT0047095
Sequence

1 - 

uuccuaugcauauacuucuuu

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-202-3p

Accession MIMAT0047096
Sequence

37 - 

agagguauauggcaugggaaaa

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).