Stem-loop sequence cpo-mir-200c

AccessionMI0038694 (change log)
DescriptionCavia porcellus miR-200c stem-loop
Stem-loop
   ----    -      u        u   u   g 
5'     cguc uuaccc gcaguguu ggg gcu g
       |||| |||||| |||||||| ||| ||| u
3'     guag aauggg cgucauaa cuc ugg u
   ggag    u      c        u   -   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562962.1: 310456-310518 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-200c
cpo-mir-200cDS562962.1: 310456-310518 [-]
cpo-mir-141DS562962.1: 310108-310172 [-]
Database links

Mature sequence cpo-miR-200c-5p

Accession MIMAT0047093
Sequence

1 - 

cgucuuacccugcaguguuugg

 - 22

Get sequence
Evidence not experimental

Mature sequence cpo-miR-200c-3p

Accession MIMAT0047094
Sequence

39 - 

uaauacugccggguaaugaugga

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).