Stem-loop sequence cpo-mir-200b

AccessionMI0038693 (change log)
DescriptionCavia porcellus miR-200b stem-loop
Stem-loop
   --    -    ug     c      u  ug 
5'   cauc uuac  ggcag auugga gg  u
     |||| ||||  ||||| |||||| ||  c
3'   guag aaug  ccguc uaaucu cu  u
   ca    u    gu     a      -  gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS563041.1: 1150409-1150467 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-200b
cpo-mir-200bDS563041.1: 1150409-1150467 [-]
cpo-mir-200aDS563041.1: 1149699-1149759 [-]
cpo-mir-429DS563041.1: 1148974-1149032 [-]
Database links

Mature sequence cpo-miR-200b-5p

Accession MIMAT0047091
Sequence

1 - 

caucuuacugggcagcauugga

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-200b-3p

Accession MIMAT0047092
Sequence

37 - 

uaauacugccugguaaugaugac

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).