Stem-loop sequence cpo-mir-200a

AccessionMI0038692 (change log)
DescriptionCavia porcellus miR-200a stem-loop
Stem-loop
   --    -             c    uu  uu 
5'   cauc uuaccggacagug ugga  uc  g
     |||| ||||||||||||| ||||  ||  g
3'   guag aauggucugucac aucu  ag  c
   uu    c             a    -c  uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS563041.1: 1149699-1149759 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-200a
cpo-mir-200bDS563041.1: 1150409-1150467 [-]
cpo-mir-200aDS563041.1: 1149699-1149759 [-]
cpo-mir-429DS563041.1: 1148974-1149032 [-]
Database links

Mature sequence cpo-miR-200a-5p

Accession MIMAT0047089
Sequence

1 - 

caucuuaccggacagugcugga

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-200a-3p

Accession MIMAT0047090
Sequence

39 - 

uaacacugucugguaacgauguu

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).