Stem-loop sequence cpo-mir-197

AccessionMI0038688 (change log)
DescriptionCavia porcellus miR-197 stem-loop
Stem-loop
   --c    a       ca    ga   -   a 
5'    gggu gagaggg  gugg  ggu aag g
      |||| |||||||  ||||  ||| |||  
3'    ccca cucuucc  cacu  cca uuc c
   cga    c       ac    uc   c   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562857.1: 33750403-33750463 [+]
intergenic
Database links

Mature sequence cpo-miR-197-5p

Accession MIMAT0047084
Sequence

1 - 

cggguagagagggcagugggagg

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-197-3p

Accession MIMAT0047085
Sequence

40 - 

uucaccaccuucuccacccagc

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).