Stem-loop sequence cpo-mir-196b

AccessionMI0038687 (change log)
DescriptionCavia porcellus miR-196b stem-loop
Stem-loop
   --u       u  c           ucca 
5'    agguagu uc uguuguuggga    c
      ||||||| || |||||||||||     
3'    uccguca ag acgacagcucu    c
   acu       c  c           cuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562899.1: 3907441-3907498 [-]
intergenic
Database links

Mature sequence cpo-miR-196b-5p

Accession MIMAT0047082
Sequence

1 - 

uagguaguuuccuguuguuggga

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-196b-3p

Accession MIMAT0047083
Sequence

36 - 

ucgacagcacgacacugccuuca

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).