Stem-loop sequence cpo-mir-196c

AccessionMI0038686 (change log)
DescriptionCavia porcellus miR-196c stem-loop
Stem-loop
   --           a          a ug   
5'   uagguaguuuc uguuguuggg u  ag 
     ||||||||||| |||||||||| |  | u
3'   guccgucaaag acaacggcuc a  uu 
   ga           a          a gu   
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562864.1: 45819379-45819437 [-]
intergenic
Database links

Mature sequence cpo-miR-196c-5p

Accession MIMAT0047080
Sequence

1 - 

uagguaguuucauguuguuggga

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-196c-3p

Accession MIMAT0047081
Sequence

37 - 

ucggcaacaagaaacugccugag

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).