Stem-loop sequence cpo-mir-196a

AccessionMI0038685 (change log)
DescriptionCavia porcellus miR-196a stem-loop
Stem-loop
   --ua   a    c         --------   c 
5'     ggu guuu auguuguug        ggc u
       ||| |||| |||||||||        |||  
3'     cca caaa uacaacaac        ucg g
   uagc   c    c         aaaagucu   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562908.1: 8623790-8623849 [+]
intergenic
Database links

Mature sequence cpo-miR-196a-5p

Accession MIMAT0047078
Sequence

1 - 

uagguaguuucauguuguuggg

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-196a-3p

Accession MIMAT0047079
Sequence

39 - 

caacaacaucaaaccacccgau

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).