Stem-loop sequence cpo-mir-195

AccessionMI0038684 (change log)
DescriptionCavia porcellus miR-195 stem-loop
Stem-loop
   --u          -a         --   g g 
5'    agcagcacag  aauauuggc  acu g a
      ||||||||||  |||||||||  ||| |  
3'    ucgucguguu  uuauaaccg  uga c a
   acc          gg         uc   a g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562916.1: 9617085-9617145 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-195
cpo-mir-497DS562916.1: 9616778-9616850 [+]
cpo-mir-195DS562916.1: 9617085-9617145 [+]
Database links

Mature sequence cpo-miR-195-5p

Accession MIMAT0047076
Sequence

1 - 

uagcagcacagaaauauuggca

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-195-3p

Accession MIMAT0047077
Sequence

39 - 

ccaauauugguugugcugcucca

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).