Stem-loop sequence cpo-mir-194

AccessionMI0038683 (change log)
DescriptionCavia porcellus miR-194 stem-loop
Stem-loop
   --u         acuccauguggaagugc 
5'    guaacagca                 c
      |||||||||                  
3'    uauugucgu                 c
   guc         cggggugaccuugguca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562897.1: 5717423-5717480 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-194
cpo-mir-194DS562897.1: 5717423-5717480 [-]
cpo-mir-192DS562897.1: 5717225-5717289 [-]
Database links

Mature sequence cpo-miR-194-5p

Accession MIMAT0047074
Sequence

1 - 

uguaacagcaacuccauguggaa

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-194-3p

Accession MIMAT0047075
Sequence

37 - 

ccaguggggcugcuguuaucug

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).