Stem-loop sequence cpo-mir-193b

AccessionMI0038682 (change log)
DescriptionCavia porcellus miR-193b stem-loop
Stem-loop
   --    gu    a    g  a  ag uua 
5'   cggg  uuug gggc ag ug  u   u
     ||||  |||| |||| || ||  |   g
3'   gccc  aaac cccg uc ac  a   u
   uc    ug    a    g  a  cu uuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562859.1: 33124944-33125002 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-193b
cpo-mir-193bDS562859.1: 33124944-33125002 [+]
cpo-mir-365-1DS562859.1: 33129619-33129680 [+]
Database links

Mature sequence cpo-miR-193b-5p

Accession MIMAT0047072
Sequence

1 - 

cgggguuuugagggcgagauga

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-193b-3p

Accession MIMAT0047073
Sequence

38 - 

aacuggcccacaaagucccgcu

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).