Stem-loop sequence cpo-mir-193a

AccessionMI0038681 (change log)
DescriptionCavia porcellus miR-193a stem-loop
Stem-loop
   --    u     cg   g  a    ggu 
5'   uggg cuuug  ggc ag ugag   g
     |||| |||||  ||| || ||||    
3'   accc gaaac  ccg uc acuu   u
   ug    u     au   g  a    ggc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562887.1: 15064360-15064415 [-]
intergenic
Database links

Mature sequence cpo-miR-193a-5p

Accession MIMAT0047070
Sequence

1 - 

ugggucuuugcgggcgagauga

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-193a-3p

Accession MIMAT0047071
Sequence

35 - 

aacuggccuacaaagucccagu

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).