Stem-loop sequence cpo-mir-192

AccessionMI0038680 (change log)
DescriptionCavia porcellus miR-192 stem-loop
Stem-loop
   --c         -     a       -----u  u 
5'    ugaccuaug aauug cagccag      gc g
      ||||||||| ||||| |||||||      || u
3'    acuggauac uuaac gucgguc      cg c
   gac         c     c       uccccu  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562897.1: 5717225-5717289 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-192
cpo-mir-194DS562897.1: 5717423-5717480 [-]
cpo-mir-192DS562897.1: 5717225-5717289 [-]
Database links

Mature sequence cpo-miR-192-5p

Accession MIMAT0047068
Sequence

1 - 

cugaccuaugaauugacagcc

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-192-3p

Accession MIMAT0047069
Sequence

44 - 

cugccaauuccauaggucacag

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).