Stem-loop sequence cpo-mir-191

AccessionMI0038679 (change log)
DescriptionCavia porcellus miR-191 stem-loop
Stem-loop
   --c          c  aa       uu  -  u 
5'    aacggaaucc aa  gcagcug  gu cu g
      |||||||||| ||  |||||||  || ||  
3'    uugcuuuagg uu  cgucgac  ua ga a
   ccc          -  cg       cu  c  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562863.1: 24185925-24185988 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-191
cpo-mir-191DS562863.1: 24185925-24185988 [-]
cpo-mir-425DS562863.1: 24185548-24185610 [-]
Database links

Mature sequence cpo-miR-191-5p

Accession MIMAT0047066
Sequence

1 - 

caacggaaucccaaaagcagcug

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-191-3p

Accession MIMAT0047067
Sequence

43 - 

gcugcgcuuggauuucguuccc

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).