Stem-loop sequence cpo-mir-190a

AccessionMI0038677 (change log)
DescriptionCavia porcellus miR-190a stem-loop
Stem-loop
   --u                ua     uuau 
5'    gauauguuugauauau  gguug    u
      ||||||||||||||||  |||||     
3'    uuauacaaacuauaua  ucaac    u
   ucc                --     cuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562953.1: 858171-858228 [+]
intergenic
Database links

Mature sequence cpo-miR-190a-5p

Accession MIMAT0047062
Sequence

1 - 

ugauauguuugauauauuagguug

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-190a-3p

Accession MIMAT0047063
Sequence

37 - 

acuauauaucaaacauauuccu

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).