Stem-loop sequence cpo-mir-188

AccessionMI0038676 (change log)
DescriptionCavia porcellus miR-188 stem-loop
Stem-loop
   --  uc         gu      ugag  u 
5'   ca  ccuugcaug  ggaggg    cu u
     ||  |||||||||  ||||||    ||  
3'   gu  gggacguac  ccuccc    gg c
   ac  uu         ac      caaa  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562987.1: 3003465-3003524 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-188
cpo-mir-532DS562987.1: 3003104-3003162 [+]
cpo-mir-188DS562987.1: 3003465-3003524 [+]
cpo-mir-500aDS562987.1: 3008302-3008367 [+]
cpo-mir-362DS562987.1: 3009085-3009144 [+]
cpo-mir-501DS562987.1: 3009773-3009832 [+]
cpo-mir-500bDS562987.1: 3010278-3010339 [+]
cpo-mir-660DS562987.1: 3012570-3012628 [+]
Database links

Mature sequence cpo-miR-188-5p

Accession MIMAT0047060
Sequence

1 - 

caucccuugcaugguggaggg

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-188-3p

Accession MIMAT0047061
Sequence

40 - 

cucccacaugcaggguuugca

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).