Stem-loop sequence cpo-mir-187

AccessionMI0038675 (change log)
DescriptionCavia porcellus miR-187 stem-loop
Stem-loop
   --    a           c  -  c - ug 
5'   ggcu caacacaggac cg gg g c  a
     |||| ||||||||||| || || | |   
3'   ccga guuguguucug gc cc c g  u
   gg    c           u  u  c a uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562869.1: 28433765-28433822 [+]
intergenic
Database links

Mature sequence cpo-miR-187-5p

Accession MIMAT0047058
Sequence

1 - 

ggcuacaacacaggacccgggc

 - 22

Get sequence
Evidence not experimental

Mature sequence cpo-miR-187-3p

Accession MIMAT0047059
Sequence

37 - 

ucgugucuuguguugcagccgg

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).