Stem-loop sequence cpo-mir-186

AccessionMI0038674 (change log)
DescriptionCavia porcellus miR-186 stem-loop
Stem-loop
   --          u     u      ucuggu 
5'   caaagaauuc ccuuu gggcuu      u
     |||||||||| ||||| ||||||       
3'   guuuuuuaag ggaaa cccgaa      u
   gg          u     -      uuguau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562857.1: 63505139-63505199 [+]
intergenic
Database links

Mature sequence cpo-miR-186-5p

Accession MIMAT0047056
Sequence

1 - 

caaagaauucuccuuuugggcuu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-186-3p

Accession MIMAT0047057
Sequence

40 - 

gcccaaaggugaauuuuuuggg

 - 61

Get sequence
Evidence not experimental

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).