Stem-loop sequence cpo-mir-185

AccessionMI0038673 (change log)
DescriptionCavia porcellus miR-185 stem-loop
Stem-loop
   --u    a     g         au  uc 
5'    ggag gaaag caguuccug  gg  c
      |||| ||||| |||||||||  ||   
3'    ucuc cuuuc gucggggac  cc  c
   ugg    -     g         -c  uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562859.1: 19120765-19120820 [+]
intergenic
Database links

Mature sequence cpo-miR-185-5p

Accession MIMAT0047054
Sequence

1 - 

uggagagaaaggcaguuccuga

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-185-3p

Accession MIMAT0047055
Sequence

36 - 

aggggcuggcuuuccucuggu

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).