Stem-loop sequence cpo-mir-184

AccessionMI0038672 (change log)
DescriptionCavia porcellus miR-184 stem-loop
Stem-loop
   --        c      a c     u   ug 
5'   ccuuauca uuuucc g ccagc uug  a
     |||||||| |||||| | ||||| |||  u
3'   ggaauagu aagagg c gguug gac  u
   ug        c      - a     u   ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS563045.1: 619298-619359 [+]
intergenic
Database links

Mature sequence cpo-miR-184-5p

Accession MIMAT0047052
Sequence

1 - 

ccuuaucacuuuuccagcccagc

 - 23

Get sequence
Evidence not experimental

Mature sequence cpo-miR-184-3p

Accession MIMAT0047053
Sequence

41 - 

uggacggagaacugauaagggu

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).